BiBiServ Logo
Attention:
Due to technical maintenance some tools might be unavailable.
See maintenance information.
BiBiServ -
                                    Bielefeld         University Bioinformatic Service
Tools
Education
Administration
Tools
Genome Comparison
Gecko
REPuter
...more
Alignments
PoSSuMsearch2
ChromA
...more
Primer Design
GeneFisher2
RNA Studio
RNAshapes
KnotInFrame
RNAhybrid
...more
Evolutionary Relationship
ROSE
...more
Others
XenDB
jPREdictor
...more

biodomws - Manual


biodomws - Input

First of all you have to choose the input and output format for your request. The input itself can be provided in two different ways. Either by file uploading or by pasting the sequence in the appropriate field. Depending on the chosen format, the input must look like:

FASTA
The first line starts with '>'. The first word afterwards is the sequence name, followed by its description. . The following line(s) contain the sequence data. It is recommened to limit the line length to 80 characters. Further sequences are possible.
    >Sequence_1 Comment
    ABCAHCANCNCNAHCHACHAHCNBN
    AHCHACHAHCBABBCLCKLAHACHN
    >Sequence_2 Comment2
    BDABCBACBABBCKLAKLCKLABKN
    BCBACBABBBCAHCANCBABBCLCK
Clustal
The first line starts with CLUSTAL. The following lines contain the alignment in blocks of a fixed length. Each line starts with the sequence name, followed by at least one space character and the sequence data:
    CLUSTAL W (1.8) multiple sequence alignment

    Homo_sapiens        AGUCGAGUC---GCAGAAAC
    Pan_paniscus        AGUCGCGUCG--GCAGAAAC
    Gorilla_gorilla     AGUCGCGUCG--GCAGAUAC
    Pongo_pigmaeus      AGUCGCGUCGAAGCAGA--C

    Homo_sapiens        GCAUGAC-GACCACAUUUU-
    Pan_paniscus        GCAUGACGGACCACAUCAU-
    Gorilla_gorilla     GCAUCACGGAC-ACAUCAU
    Pongo_pigmaeus      GCAUGACGGACCACAUCAUC
DotBracketFasta
DotBracketFasta is a format to cobine a sequence and its secondary structure in one string. This pair of sequence and secondary structure starts with '>' and the sequence name. The next line contains the sequence data (FASTA format). The third line represents the secondary structure and consists of . ( ) [ ] { } < > (Dot-Bracket Format). Further pairs of sequences and secondary structure are possible.
    >Sequence_1
    UAAUCGGGUGCAACUCCCGCCCUUUUCCGAGGUCAUCGGA
    ....((((.......))))[[....{{{{{]]...}}}}}
    >Sequence_2
    UAAUCGGGUGCAACUAACCGGAACCUCCGAGGUCAUCGGA
    ....((((..(()).))))[[....{{{{{]]...}}}}}
AlignedDotBracketFasta
AlignedDotBracketFasta is a format to cobine multiple sequences with secondary structures in one string. It contains at least two pairs of sequence and secondary structure. A sequence starts with '>' and the sequence name. The next line contains the sequence data (FASTA format). The third line represents the secondary structure and consists of - . ( ) [ ] { } < > (Dot-Bracket Format). Further pairs of sequences and secondary structure are possible.
    >Sequence_1
    AAA-CGG-ACGTA
    (..(-..)(-).)
    >Sequence_2
    ATTGC-A-TTAAC
    ..((..-..).-)
AlignmentML
The input must be a xml file or xml data with the grammar. For example:
    alignmentml.xml
SequenceML
The input must be a xml file or xml data with the grammar. For example:
    sequenceml.xml
RNAStructML
The input must be a xml file or xml data with the grammar. For example:
    rnastructml.xml
RNAStructAlignmentML
The input must be a xml file or xml data with the grammar. For example:
    rnastructalignmentml.xml

biodomws - Output

The output is a generated file that contains the converted sequence in the chosen output format
Welcome
Submission
WebService
Manual
Contact
Wed Dec 19 13:56:33 2012