BiBiServ Logo
Attention:
Due to technical maintenance some tools might be unavailable.
See maintenance information.
BiBiServ -
                                    Bielefeld         University Bioinformatic Service
Tools
Education
Administration
Tools
Genome Comparison
Gecko
REPuter
...more
Alignments
PoSSuMsearch2
ChromA
...more
Primer Design
GeneFisher2
RNA Studio
RNAshapes
KnotInFrame
RNAhybrid
...more
Evolutionary Relationship
ROSE
...more
Others
XenDB
jPREdictor
...more

KnotInFrame - Manual

Sequence file:
The input can be provided in two different ways. Either by uploading a file containing a single or multiple sequences or
by pasting one or more sequences in the appropriate field. The sequences must be in FASTA format: The first line starts
with '>', followed by a sequence name and an optional sequence description. All remaining lines are sequence data.
Sequences can be either DNA or RNA, all non-nucleotide (i.e. not A,C,G,T,U,N) characters will be deleted, characters can
be in upper or lower case, even mixed.
The following is an example of a FASTA format file with two sequences:
>pol_m_vir_hastr|150_Nucleotides
CCAAGAGGGGGGTGGTGATTGGCCTTTGGCTTATCAGTGTGTATATAAGATTTCTACACTCTTTTATCAAGTACT
CTACAGGATGGCACACGGTGAGCCATACTACAGTTCTAAACCTGACAAAGATTTCAATTTTGGAAGCACAATGGC
      
>pol_m_vir_mhv|225_Nt|Accession:AF029248.1
TATAAGAGTGATTGGCGTCCGTACGTACCCTCTCAACTCTAAAACTCTTGTAGTTTAAATCTAATCTAAACTTTA
TAAACGGCACTTCCTGCGTGTCCATGCCCGCGGGCCTGGTCTTGTCATAGTGCTGACATTTGTAGTTCCTTGACT
TTCGTTCTCTGCCAGTGACGTGTCCATTCGGCGCCAGCAGCCCACCCATAGGTTGCATAATGGCAAAGATGGGCA
            
Number of predictions:
Sometimes for long input sequences there will be a lot of results, but only the best ones are of interest. So user can
determine the n best predictions that will be displayed by KnotInFrame. Default is n=10, delimit or expand it (n=1..50)
if necessary.
Welcome
Submission
WebService
References
Manual
Contact
Fri Dec 14 12:54:13 2012