|
Attention:
Due to technical maintenance some tools might be unavailable. See maintenance information. 
|
|
|
|
|
|
KnotInFrame - Manual |
|
Sequence
file: The input can be provided in two different ways. Either by uploading a file containing a single or multiple sequences or by pasting one or more sequences in the appropriate field. The sequences must be in FASTA format: The first line starts with '>', followed by a sequence name and an optional sequence description. All remaining lines are sequence data. Sequences can be either DNA or RNA, all non-nucleotide (i.e. not A,C,G,T,U,N) characters will be deleted, characters can be in upper or lower case, even mixed. The following is an example of a FASTA format file with two sequences:
>pol_m_vir_hastr|150_Nucleotides
CCAAGAGGGGGGTGGTGATTGGCCTTTGGCTTATCAGTGTGTATATAAGATTTCTACACTCTTTTATCAAGTACT
CTACAGGATGGCACACGGTGAGCCATACTACAGTTCTAAACCTGACAAAGATTTCAATTTTGGAAGCACAATGGC
>pol_m_vir_mhv|225_Nt|Accession:AF029248.1
TATAAGAGTGATTGGCGTCCGTACGTACCCTCTCAACTCTAAAACTCTTGTAGTTTAAATCTAATCTAAACTTTA
TAAACGGCACTTCCTGCGTGTCCATGCCCGCGGGCCTGGTCTTGTCATAGTGCTGACATTTGTAGTTCCTTGACT
TTCGTTCTCTGCCAGTGACGTGTCCATTCGGCGCCAGCAGCCCACCCATAGGTTGCATAATGGCAAAGATGGGCA
|
| Number of predictions: Sometimes for long input sequences there will be a lot of results, but only the best ones are of interest. So user can determine the n best predictions that will be displayed by KnotInFrame. Default is n=10, delimit or expand it (n=1..50) if necessary. |
 |
 |
 |
 |
 |
 |
 |
|
|
|