University of Bielefeld - Technische Fakultaet - AG Praktische Informatik



paRNAss - Prediction of Alternating RNA Secondary Structures
Authors: Bjoern Voss

paRNAss

Results


Sequence Name: Tetrahymena Group I intron
Sequence: gatttctgcccagtgctctgaatgtcaaagtgacgcaattcaaccaagcgcgggtaaacggcgggagtaactatgactctctaaatagcaatatttacctttggaggg
P-value: 1.6 kcal/mol
Searchspace: canonicals
Folding-Temperature: 37
Maximal number of structures: 20 chosen out of 20 structures generated by RNAsubopt (100 %).

Morphological Distance Plot

String Edit Distance Plot

Tree alignment Distance Plot


mfe = -24.96 kcal/mol

paRNAss selected the following structures.




Clustering Results

Results based on Morphological Distance

Tree resulting from clustering: Dendrogram
Plots of suggested alternative structures: Structure 1, Structure 2
RNA-Movie of structure transition: RNA Movies online Version, RNA Movies locally installed
The pseudoknot distance of the consensus structures is: 34

Results based on Energy Barrier Distance

Tree resulting from clustering: Dendrogram
Plots of suggested alternative structures: Structure 1, Structure 2
RNA-Movie of structure transition: RNA Movies online Version, RNA Movies locally installed
The pseudoknot distance of the consensus structures is: 33

Results based on Tree Alignment Distance

Tree resulting from clustering: Dendrogram
Plots of suggested alternative structures: Structure 1, Structure 2
RNA-Movie of structure transition: RNA Movies online Version, RNA Movies locally installed
The pseudoknot distance of the consensus structures is: 34

Validation (consensus structures taken from clustering based on morphological distance)




Validation (consensus structures taken from clustering based on energy barrier)




Validation (consensus structures taken from clustering based on tree alignment distance)







Any comments, suggestions or technical problems? Please send email to bibi-help(at)techfak.uni-bielefeld.de


Created: Wed Dec 3 13:15:41 2003
Version 1.5