Attention:
Due to technical maintenance some tools might be unavailable.
See maintenance information.

BiBiServ -
Bielefeld University Bioinformatic Service

pknotsRG - Examples

The following sequences are taken from the pseudoknot database Pseudobase .
The first structure in dot bracket notation shows the reference structure from the database.

pknotsRG-mfe delivers the energetically best structure. If the sequence in nature folds into a pseudoknot it is likely that this structure is the mfe-structure and thus will be detected, using this tool. An example prediction along with the reference structure follows here:

> PKB5 -- tRNA-like structure from turnip yellow mosaic virus
UUAGCUCGCCAGUUAGCGAGGUCUGUCCCCACACGACAGAUAAUCGGGUGCAACUCCCGCCCCUUUUCCGAGGGUCAUCGGAACCA
....(((((......))))).((((((.......))))))....((((.......))))[[[....{{{{{]]]...}}}}}....           -- reference
....(((((......)))))(((((((.......)))))))...((((.......))))[[[...{{{{{{]]]...}}}}}}...  (-30.00) -- pknotsRG-mfe

In some cases the optimal pseudoknotted structure is dominated by an unknotted structure. Thus, using pknotsRG-mfe yields an incorrect structure (e.g. one of the stems is not detected). However, enforcing a pseudoknot with pknotsRG-enf, yields the desired pseudoknot:

>PKB00117 - Pseudoknot PKc of the upstream pseudoknot domain (UPD) of the 3'-UTR of beet soil-borne virus RNA 2
ACGUGGGUUAUACGAUAAUAACCG
.(((.[[[[[[)))...]]]]]].          
.....((((((......)))))). (-5.6)   -- predicted structure by pknotsRG-mfe 
.[[[[.{{{{]]]]....}}}}.. (-3.8)   --                        pknotsRG-enf


> PKB00210 - Pseudoknot PK2 of Bordetella pertussis tmRNA
 111111  222   3333333  222                                          111111       3333333
CCGCUGCACUGAUCUGUCCUUGGGUCAGGCGGGGGAAGGCAACUUCCCAGGGGGCAACCCCGAACCGCAGCAGCGACAUUCACAAGGAAU
.[[[[[[..[[[...{{{{{{{..]]].((((((((((....)))))).((((....))))...)))).]]]]]].......}}}}}}}.
.[[[[[[.........{{{{{{......((((((((((....)))))).((((....))))...)))).]]]]]].......}}}}}}.. (-45.60) -- pknotsRG-enf
.((((((.(((((((......)))))))((((((((((....)))))).((((....))))...)))).))))))..((((.....)))) (-49.40) -- pknotsRG-mfe

Note in the second example that the pseudoknot actually consists of three interacting helices, denoted by the numbers 1, 2 and 3. But, our canonization allows only for pseudoknots with two stems. This is the reason, why the small stem 2 is not detected.