Attention:
Due to technical maintenance some tools might be unavailable.
See maintenance information.

BiBiServ -
Bielefeld University Bioinformatic Service

pknotsRG - Manual

pknotsRG - Input

The input can be provided in two different ways. Either by file uploading or by pasting the sequence in the appropriate field. The sequence must be in FASTA format:The first line starts with '>', followed by a sequence id and an optional sequence description. All remaining lines are sequence data.

>12345 | TYMV
UUAGCUCGCCAGUUAGCGAGGUCUGUCCCCACACGACAGAUAAUCGGGUG
CAACUCCCGCCCCUCUUCCGAGGGUCAUCGGAACCA

Approximate running times of pknotsRG on the BiBiserv are

Nucleotides	200	400	800
~computation time	<1 s	<1 min	<10 min

Actual running times may vary, depending on the actual server load and the machine your job is dispatched to. If you do not want to wait online for the result, you can bookmark the reload page, to which you are redirected upon submission. You can then revisit your results for three days using the bookmark.

pknotsRG - Output

Depending on whether the user chooses to compute suboptimals or not, there are two different ways how the result is displayed:

MFE structure only: The computed secondary structure is displayed in Vienna (Dot-Bracket) Notation and the minimum free energy in kcal/mol.
```
>id description
UUAGCUCGCCAGUUAGCGAGGUCUGUCCCCACACGACAGAUAAUCGGGUGCAACUCCCGCCCCUCUUCCGAGGGUCAUCGGAACCA
....(((((......)))))(((((((.......)))))))...((((.......)))).[[[[[.{{{]]]]].....}}}.... (-30.0)
```
Unpaired bases are indicated by dots. Base pairs are written as bracket pairs. The first stem of a pseudoknot is indicated by '[' and ']', the second stem by '{' and '}'.
A 2D visualization is generated using the PseudoViewer Web service . Also, a link to a Connect formatted file, originally used by Michael Zukers mfold, is provided.
Suboptimal solutions: The list of suboptimal solutions is displayed as an RNAmovie . RNAmovies displays the individual suboptimal structures one after another with an adjustable number of intermediate transition steps. This allows for a smooth morphing from one structure to the next. Additionally, all suboptimal structures are displayed as Vienna strings along with their respective energy value at the bottom of the result page.