BiBiServ Logo
Attention:
Due to technical maintenance some tools might be unavailable.
See maintenance information.
BiBiServ -
                                    Bielefeld         University Bioinformatic Service
Tools
Education
Administration
Tools
Genome Comparison
Gecko
REPuter
...more
Alignments
PoSSuMsearch2
ChromA
...more
Primer Design
GeneFisher2
RNA Studio
RNAshapes
KnotInFrame
RNAhybrid
...more
Evolutionary Relationship
ROSE
...more
Others
XenDB
jPREdictor
...more

RNAforester - Manual

RNAforester calculates the similarity between two or multiple RNA secondary structures. Note that the scoring scheme for pairwise and multiple alignments differs slightly (see below).

Input
The input sequences/structures are required in Vienna (DotBracket) format. The first line if a sequence/structure block starts with an '>' character followed by an id (first word) and an optional description. The next line contains the sequence information and the last line of a block contains the structure information, where matching brackets symbolize base-pairs and unpaired bases are represented by dots. An example is given below:
>id1 description
accaguuacccauucgggaaccggu
.((..(((...)))..((..)))).
>id2 description
...
Global, local and small-in-large alignment

Local similarity means finding the maximal similarity between substructures of RNA secondary structures. If these substructures are extended, the score decreases. This requires a scoring scheme that balances positive and negative scoring contributions. Otherwise, the similarity of the complete structures would always achieve the maximum score. It is generally assumed that an alignment of two empty structures scores zero. A localized variant of distance makes no sense, as empty forests have always the lowest possible distance of zero.

Local similarity
Substructures of RNA secondary structures can be defined in different ways. Here, it means that the substructures are contiguous and ``closed'' by hairpin loops. (no stem without its closing loop(s)!) The blue regions shows a vaild substructure. The green part of the structure is not closed because the closing hairpin is missing. The red part shows a substructure that is not considered as a local structure for the same reason. However, this is less obvious since only the $U$, which is a child of the root of this subtree, is not included. If the top-level $P$ node would not be included in the red substructure, this part would correspond to a closed subforest. The yellow part does not correspond to a closed subforest since the subtrees are not consecutive siblings.
Scoring models

Structural edit operations
Structural edit operations of Jiang et al.'s general edit model for RNA structures.

The sequence edit operations base match, base mismatch and base deletion are the same for pairwise and multiple alignment. A base pair breaking means the deletion of a base-pair bond. A base-pair deletion is the composition of a base-pair breaking and two base deletions. A base-pair altering is treated likewise but there is only one base-deletion involved. The structural edit operations base pair replacement and have a different effect for pairwise and multiple alignment. In pairwise alignment mode, the pairing bases are treated as a unit. In multiple alignment mode, base pair replacement score means the score for matching any base-pair plus the score for matching or mismatching the bases that pair. Thus, it is not possible to construct a base-pair dependend scoring for this model. The RIBOSUM scoring scheme are empirically derived base-pair and single base substitution scores that are available in pairwise alignment mode.

Multiple alignment mode
Output
Welcome
Submission
WebService
References
Manual
Contact
Thu Dec 20 16:05:22 2012